Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594227
Length 616 bp
Fasta Format > rwhsd19k09
gtacaacaaactcccgtctctgctcaaagggagtgaacgaacaatcaaac gctgatacaaaatagatacaacagtggccggctatgcagagctggctcga cgtacgtactcctgtctctcacatggagatcatatcagagcatttattca tgtatatgtgtatatatatatatatatatgtgtgtgtgtgacctcaacgt actcggcatctatcgctggagctataatcggcgatgatggcggcaagtaa tcgatcagtggatcttagagcagtccacggatgcgctgatggagtagggg atgctgacgccgcacttggaggggatacttgcagcctttccggggttgag cccaccggcagcactcttgatgcacctgcatgccgcttgcttgtcggcgg tgctccgcgctaagccggccaatctcctaactccggaacagcaggcccca ggcgggctggccccgctgccttttgcgtaagagacgcaggaggccagggc agagttcacctgaccgcangagatcgccgcgtcggaggctaccaggagca ttgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagcc atctcgaccgagttag
Download
page-top