Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594208
Length 609 bp
Fasta Format > rwhsd19j05
aggacaccaaacatcaatacaacagtgtggcctgccatgcagagctggcc ggacgtaggtactcctctcgctgtcacgcagtgagataatatgagagcac ttattcatatatatgtatatgtatgtgtatgacctcaacgtactcagcgt agatcgctggagctatatgcagcgatgatgagaagaagtggtcgatcaac gaatcttagaacagtccacagatgagctgatggcgtaggggacgctgacg ccgcactttgaagggatgccggcggccttgccagcgttgagcccaccagc agcgctcttgatgcacttgcacgctgcttgcttgtcagcggtgctccggg ctgcaccggccagactcctgacgccgctgcagcaggccgcaggcgggttg gcgccattgccgcgtgcataggagatgcaggggctcaaggcagaggtcac ctgaccgcaggatatcgccgcatcgcaggctacgaggagcatagcggcca ccatggagaccagcacgagctgagtagctgcaccgcgagccatccctatt gagtttgcagtagtagtggtgttgagctcanctggagatggtgagatggg ctanatttg
Download
page-top