Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594192
Length 608 bp
Fasta Format > rwhsd19i09
ggacaccaaacatcaatacaacagtgtggcctgccatgcagagctggccg gacgtaggtactcctctcgctgtcacgcagtgagataatatgagagcact tattcatatatatgtatatgtatgtgtatgacctcaacgtactcagcgta gatcgctggagctatatgcagcgatgatgagaagaagtggtcgatcaacg aatcttagaacagtccacagatgagctgatggcgtaggggacgctgacgc cgcactttgaagggatgccggcggccttgccagcgttgagcccaccagca gcgctcttgatgcacttgcacgctgcttgcttgtcagcggtgctccgggc tgcaccggccagactcctgacgccgctgcagcaggccgcaggcgggttgg cgccattgccgcgtgcataggagatgcaggggctcaaggcagaggtcacc tgaccgcaggatatcgccgcatcgcaggctacgaggagcatagcggccac catggagaccagcacgagctgagtagctgcaccgcgagccatccctattg agtttgcagtagtagtggtgttgagctcagctggagatggtgagatgggc tagatttg
Download
page-top