Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594182
Length 229 bp
Fasta Format > rwhsd19h21
tacaacaaactcccggtctctgctcaaagggagtgaacgaacaatcaaac gctgatacaaaatagatacaacagtggccggctatgcagagctggctcga cgtacgtactcctgtctctcacatggagatcatatcagagcatttattca tgtatatgtgtatatatatatatatatatgtgtgtgtgtgacctcaacgt actcggcatctatcgctggagctataatc
Download
page-top