Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594012
Length 683 bp
Fasta Format > rwhsd18n09
atgcacgcccgattaaatcgcgtgcgtagtgcaatacaaaaggaagggaa agtacaactcgcanacttgaacaggtgacgctgccgacaggcacacacac cgaggaggggaggaacagcacggtagatatagatgattacagcgtgcgcg gccgagacatgatccacgtactacgcgcgcgcgagcaaccaccaccacca ccacatgatcgatcgaccgacgatgaacagcgataagattccattcncgg ctggttgattggtggactagtcncggctcttgaaggggatggnccggatc accaccacgtggtagatggccgccagcgccgcgccgatgaacgggcccac ccagaagatccagtggtcgtcccacgcctgcttcttgttgtatatgatgg cggcgccgagggacctcgccgggttgatgccggtccccgtgatggggatc gtcnccaggtgcaccaggaacaccgcgaacccgatcggaagcggcgccag gatggggacgtgagagtctctggcnctgcgcttggcgtcggtggcggaga agacggtgtacaccagcacgaacgtgccgacgatctcggcgccgagcccg tcccccttggtgtacccgggcgcgacgganttggcgccnccgccgatgcc ctggtacancgtggtctggaaccccttcaccac
Download
page-top