Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ593829
Length 468 bp
Fasta Format > rwhsd18d03
gatctcccaaaatttgtcaaacacaacataagcaaaaaaaaataacaaca taagcatttcattcggaagtgtcatcggcagtgctcataaatccacccaa gaagccagcgccattgcagctcccacatagaatttcacgctttcctctgc aaagccagcataatcctccagctttgaatcggccaccgaaatggtcttcc aaattctccccacctcccttgcattgggtgcatgcgattgcgccgttccc ttcgcaggcagtgcaaacaagactgtatgccttctttttggtagcttcgg gcttcttttcgtcctggtcctttgctgctgccttggccttgagggaatgg agcctggagcagcgagagatggggcggaggaagagaacgggaggaggcga ggttctaagggcggccggaggggaggtaacggtggccgtgaggccggagg tggccgccattcgagaac
Download
page-top