Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ593760
Length 684 bp
Fasta Format > rwhsd17o17
tgtgaggactccagcaacagtnngatgagcagcagcgcctccctcctcan cacatagaaccacagcctagcaactacaaaaattcccaaaacatggctta ataaatcccaaattgtccacgaccacgactttaaagtagaaccccagcag accatttatcacttgaacccccccacccacagacaagaaagttggtgata cttcaacaaaaacaaagccctgtcaggacccccttaccatatgttctcna cagcccgcccgatcacanaaggtcggcaacgttggctgggagctcttcaa tcaccacgnngnccnancttctggatgtcaaacagcatcctctcatcttg acgggtcacaaagttgatggccacacccttccttccaaaccgaccactac gaccgatgcgatgcaggtagttctctggctgggtcgggaggtcatagttg atgaccagggacacttgctggacatcaataccacgagcaagcaggtcagt ggtgatgagcacncgtgaagaacctgatctgaactccctcatgatgatgt ccctagtgttctggtccatgtctccgtgagtggcggagactgtgtggtcc ctgcccctcatcttgtcggtgagccagtccaccttgcggcggggtgttca caaagatgacactctgggtgatggcaagagtctc
Download
page-top