Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ592464
Length 728 bp
Fasta Format > rwhsd12n15
tagcagcaaattacacgaccatagtagaacaaaaaccaccgctccgattt acgatacgcagcacccgagtaacagggtattcgactccaaaaacgaaact acctaagctattttgagagcacaagttccatactaggttcgatatccgaa ggatatatcaagactctgaaaaccaaacgataatactggtaagcaggaca cccaaacaggccaccgcaccgaaggcagatcagtacttgtagtccttgac gtggaggctctcagaggccccctcgccgagggtggcatcgcccttgtagg tgccgagggtggcctcagagttggccttgcacctcaccaggaacgccttc ctggccttctcctcgttctccaccttgccagcccaggccttgagggtgct ctgctggagggcacgcccgaaggagaaggacaggttccatggcttcttgg tctcgagcttgttcatggcgttcaggttcagggtcgcctcctcctcgctc tgtccaccagagaggaagacaatggctgggacggcagcagggacagtcct ctggagggtgcggacggtgtactcagcaatcacctcaggggccaccttct tggcgtcggatccaggggtgaccatgttgggcttcaggagggtgccctca aggaggacatgctggtcgttgagggccttgtancacgcancaaggaccat ctcantcacgtaagcacagcggtcaatg
Download
page-top