Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ592424
Length 711 bp
Fasta Format > rwhsd12l07
ttatctgggctgagagatgatggctcacagaaagctaattccacatcttt gcaactgattcctggtacaatcaaattaaaatgtgacgcttacattggct cagggaaattcattctgagatcaagcagaaacgttttctttctccgccac gatgctgtcaagtaatgactcgcatgcatcttccagcagatccagtacct tttcaaatcccttagcgcctccatagtaaggatctggaacttcagactcc gtatgccgcttgcaataggagcacatcagcttaaccttcttgggtccact atctgggagagtctccttgtgttgccatctgtcaaatgagctcaaaatgt cttcataattctgcctgtccattgcaaggataagatcaaaatttcggaaa tctgagggtttgataggcctggatattgaggtcacctcaatcccccgctt cttggaagttgatatcatccttgagtcggccttatctccctcatgataac ctatggtaccagcagagtctatctgaaacttggactcaagtccgcgcttg ctgacgaggttccggaagacggcttcagctgcaggactcctacaaatgtt cccgaggcagacgaagaggacggcgaagggcttcgcgctggcctcggccg gcgccggagtactcgcctccgcggccatctcttccgcttccgccgccgac gccacgaatac
Download
page-top