Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ592297
Length 369 bp
Fasta Format > rwhsd12c16
atagctgcataaaattcagtcacaaacacatataatcctcacattacata aaactcagtactggaacatagccagactagtattaaacaactaaatttga ccaaacacaggtaaaagcaacttccacagccaaaacaacagaacaaatca agaatcactagacaatgccatcacccctcagagttccgctgcctggatgc aagatgatgcttaccgcctacttggatcgctgcctcatctttcggcgctt cctcttgagcctcctcatcctcttcttcttccacttggccctcatcgcgg cggcggagtcggcctcgctctcctcttcgcggcggcggagtcggcggcgg aagtgtgtggacgaacccg
Download
page-top