Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ596430
Length 717 bp
Fasta Format > rwhsd8f09
aaagcttacattaggacagtatgtaaggcacaagacagacaccaccaagg gcacgatatgcagcgctaacagctgaacagctaaaatatacccagtacga acaatgcccttaacaaaactcagccaatactaaaaactgcttggtgtctg aaacagtgatttggatatcaattgtggaattacttcttcttgatggcagc cttggtcaccttggccccggttgggtccttcttctcaacgcccttgatga caccaacagccacagtctgcctcatgtcacggacagcaaaacgaccaaga ggagggtaagtggcaaaggtctccacaaccatgggcttggtgggaatcat cttcactatgccagcatcaccattcttgaggaacttgggcagggcctcca gctccttaccagaccgcctgtcgatcttggtcaccagctcagcaaacttg acagcaatgtgtgaggtgtggcagtccagcactggggcgtagccgttgcc aatctgaccagggtggttcatgatgatgacctgggaggtgaagttggctg cctccttggcagggtcatccttggagttggatgcaacaaacccacgcttc agatccttcacggcaacgttcttgacgttgaagccaacgttgtcaccagg aagcgcctccaggagagactcatggtgcatctcaacggacttgacctcag ttgtcagaccagtggga
Download
page-top