Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ596422
Length 707 bp
Fasta Format > rwhsd8e24
tacgtaataatttacatagatatgcacgcccgattaaatcgcgtgcgtag tgcaatacaaaaggaagggaaagtacaactcgcagacttgaacaggtgac gctgccgacaggcacacacaccgaggaggggaggaacagcacggtagata tagatgattacagcgtgcgcggccgagacatgatccacgtactacgcgcg cgcgagcaaccaccaccaccaccacatgatcgatcgaccgacgatgaaca gcgataagattccattcgcggctggttgattggtggactagtcgcggctc ttgaaggggatggcccggatcaccaccacgtggtagatggccgccagcgc cgcgccgatgaacgggcccacccagaagatccagtggtcgtcccacgcct gcttcttgttgtagatgatggcggcgccgagggacctcgccgggttgatg ccggtccccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaa cccgatcggaagcggcgccaggatggggacgtgagagtctctggcgctgc gcttggcgtcggtggcggagaagacggtgtacaccagcacgaacgtgccg acgatctcggcgccgagcccgtcccccttggtgtacccgggcgcgacgga nttggcgccgccgccgttgccctggtacancgtggtctggaaccccttca ccacncc
Download
page-top