Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595675
Length 425 bp
Fasta Format > rwhsd5g06
agattgcgaaaagtaaaacacncatacacaagggcaccatgcaggatgca gcgatgcagcnaagcaaccgaacaagatgcatgcatgactgactcgtact antagtatatagcgaggcacgtacgtacntgcgcgctgacggggacgatt gatggctgctgtgagagagctgctgcggtacnttgatncgatgaccggtg caggttctantttttaaacagcgctctcaggaccggacgtggccttggtg acnccngtgaactcaaccttggtgccnagnangtcgaccccgacntcngn ggtgaaggtgtcntaccggaggaacagctccaccaccaggagcctgccca cgancacgaccaggattcttgcctgggcactgcttgttgtccacgctggg gctctcggtctcccgcccgttggac
Download
page-top