Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595584
Length 291 bp
Fasta Format > rwhsd5a11
atgtcaaacagcatcctctcatcttcacgggtcncnaagttgatggccac anccttccttccaaaccgancactacgaccgatgcgatgcaggtagttct ctggctgggtcgggaggtcatagttgatgaccagggacacttgctggaca tcaataccacgagcaagcaggtcagtggtgatgagcacacgtgaagaacc tgatctgaactccctcatgatgatgtccctagtgttctggtccatgtctc cgtgagtggcggagactgtgtggtccctgcccctcatcttg
Download
page-top