Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595506
Length 605 bp
Fasta Format > rwhsd4m09
tacacaagggcaccatgcaggatgcagcgatgcagcgaagcaaccgaaca agatgcatgcatgactgactcgtantagtagtatatagcgaggcacgtac gtacgtgcgcgctgacngtncncgattgatggctgctgtgagagagctgc tgcggtacgttgatccgatgaccggtgcaggttctaatttttaaacagcg ctctcaggaccggacgtggccttggtgacgccggtgaactcaaccttggt gccgagcaggtcgaccccgacgtcggcggtgaaggtgtcgtaccggagga acagctccaccaccaggagcctgcccacgagcacgaccaggttcttgcct gggcactgcttgttgtccacgctggggctctcggtctcccgcccgttgga ccagtacacgtactgcagcagcttccttccctcctccccgacgaaccggt cgccgangaactccctcgccgtggagccgaacacgcgggggtccctggtg gcgcacggctggtacccgaacagcatctcccccttcttcacngcgaacac cgcgtcntggntctcgatgttcntgtcngccttggcgcggccgtactgga acttg
Download
page-top