Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595382
Length 728 bp
Fasta Format > rwhsd4e08
agtttacatataggatacaaatatgtttctttgcactaactttttttcct tagcatggccaactcaatatcaccatgtgttaacatgccaaaacttctct cgggcttcgggcaccggtcatcatcatttgctacttctctttacatcgga actatggaggcgaataacacagaaccataacctaaacaaaacgctaggac aaagcacatttcagatgtttctggtaagggcataaggctcctgtcatgcc gccttattggtttggcttcagggcggcattcggccccagtccaagccatg gctggttctcaaactccttcttgactggtgttgcatcagaaggagaagct tgatatggtgcctttgcatgcagacgatcctttctcttctcaaggaatcg gtgaagtgacgcctttctagcaattggcagatcagaagcattcggacgag cagacttaggagcaacaaccggatcactaggcaaactacttgccggggcc agcacggccgtctggaccttggcggtgtctgcagcagttgtggtcgcaga gacgttctgagcaaccgggctgcccttgccagccaactgcatcaggccct tggccttgtcggctgggaaatcgttgaacacgagcaccttcccaccatag aagatggtcagctggctcttgtcttcctccctagtagcgtcaggggcggc ggcgtcctgcangccggcgctctgcggg
Download
page-top