Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595354
Length 538 bp
Fasta Format > rwhsd4c16
aggacaccaaacatcaatacaacagtgtggcctgccatgcagagctggcc ggacgtaggtactcctctcgctgtcacgcagtgagataatatgagagcac ttattcatatatatgtatatgtatgtgtatgacctcaatcgtactcagcg tagatcgctggagctatatgcagcgatgatgagaagaagtggtcgatcaa cgaatcttagaacagtccacagatgagctgatggcgtaggggacgctgac gccgcactttgaagggatgccggcggccttgccagcgttgagcccaccag cagcgctcttgatgcacttgcacgctgcttgcttgtcggcggtgctccgg gctgcaccggccagactcctgacgccgctgcagcaggccgcaggcgggtt ggcgacattgccgcgtgcataggagatgcaggggctcaaggcagaggtca cctgaccgcaggatatcgccgcatcgcaggctacgaggagcatagcggcc accatggcgaccagcacgagctgagtagctgcaccgcg
Download
page-top