Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594392
Length 514 bp
Fasta Format > rwhsd1f13
tcattatcattcttgaagagaaaaccacgcaattatcaatcccgaaaaga aaaccactcatcaattattcacaccccgctgcacatggaaaaacattatt tggatccacaagacacgatccaactccaagcaggaacgcgatgccaagcg cgtacgtgattcatcgattaacttaggtggtgtagtccttgaggatgtcg agggtgagctcgctggcgtcggtggcctgcacgtcgatctgcacgccgtc cagctccttcttgagcccctccgtggagctggcgtacagcatcttgttcc tcgcgtccgccgactccggcgaccagtggatgaagaagatcttgctgcgg ggggtctcgccggccgagtcctcggacacgaagtccaggtcgtagacggc gtagcggcagtcgtcggcgggcatggccgccgccaggtcgtcgaaggtgg cgtcgagcgcgcccaccttgtccaccaccacctgctgcgcgtcgtcgtcc atcttgtacaccac
Download
page-top