Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591875
Length 704 bp
Fasta Format > rwhsd10g21
ttatcattattggcttgcaagctcaagtcagggggggaggaaaacagtag cagctgctccaccacaaaattactagcatagtacacacataataaacaca ggagaaaaaaggagtctcttcatcttcgctgtcttcctccgcaccgagag gagccacatcaagatttttcttaggcggacttcacagtggcggcgttgat gatgtcaatgaactcaggcttcaaagaagctccaccaacgaggaaaccat caacgtcgggctgccctgccaactccttgcagcttgcgccagttacagat cctccatagatgatcctcgtggattcagcaacctcggggctcacattggt cttgagccagtccctcagattggcatggacttcctgcgcctgagccggtg tcgcaactttaccggtgccaatggcccacactggttcgtaagcgacaacc acattggtccagtccttgatcttgtcagcaattgcttttgtctgttcagc gacaactgccatggttgatccagcttctcgctgctcgagagtctcaccaa cacatgcaatgaccttcaagccctgagcaagtgcatatgcaaccttctct ccaacaaactcgcttgattctcccatcaagctcctcctttcagagtgtcc aaggatgacccagggaacgccgaggttgacaagcatctcagcactgactt cacc
Download
page-top