Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591867
Length 266 bp
Fasta Format > rwhsd10g12
tgagcaaatgaacntnncttantgctctnanaatcaacnacanctgcnat ttcggggctaacaananntgctccaatgggcacatangcanacgaaagag ccttggacaangtgactaaatctggcttgatgttatacatatcagatccg aacatggttcccaaccttccaaatgcggtaatgacctcatctactatgaa aaggatgtcatacttcttaaccacagcttgaaccttatcaaaataagtct tnggaggagggatgac
Download
page-top