Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591866
Length 762 bp
Fasta Format > rwhsd10g10
aagacgtactcctatctataggaaataatgagaccantaatgagaccgct tgaggctagctatcaattcttcgggcgaactatgagttacaacaacaata tcccagagcagcagcttcagttattctgtgcgaacagcgaaaatactctt gaagtaaatttgtcgtcagaaacagtctgtgagcggaaccaactgagctc tggcaaattagagatcggcccaactgcagcaagggcaacatccttgtcaa ttataaactccttggctgttttcattactgtatcgcagtcaacagcatca atccgagcaaaaagctccaagaatggcattactcgtccataagtaagcat ctggcgaccattattttcagaaactgcagttgatccatcaaagtgaagca aaagagaggacttcaactgattacgagcacgagcaacctctgtctctgac actctgaatgcaagtcttctaaattcttccattattaaccgtgacaggtc atgtagtgcgtcaggcggagcactagtatagatgccaaataatcctgtat cgcgatagttagtgttgaatgccatcaagttctcagctagctcaccattg ctgatgccacgagctaaagcagaccctgagcagttccctacgccgatgct cctattccaagatcccaatatgctttgggtcaccataagaggaatagagc tagggtcagtcccggatgaacccttgaaagcaattgcaatatgcgctaga ggcatctcggca
Download
page-top