Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591865
Length 300 bp
Fasta Format > rwhsd10g07
tgtatgtctgaacattcaccagcgatatggaaaatatagccaagtatcta tccgttttcccgagtcacgatttcaacagcggacgtcttagaaccataat gcaacgacgggtcgagaacagttcccagatttcatgacaggacggtgacg ctggtacaaaatgcaaatccccactaaaacttattcagctcttggacact tccgaatgactgactgactgactggtataagacgacggtgctagacagac tccgccttggtgtagatccgtacggccctcgtgccgaattcggcacgagg
Download
page-top