Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591864
Length 709 bp
Fasta Format > rwhsd10g06
acaaccaaatttaagctaagaattcagaatgaaatcacacgggtagggta gtccaaataataagcattaagctgaaatcaacaatgagccaaaacatgca tcattgcattgttcacgacacacacaagtctcgtgatgctacagaccaaa aagtacaacaaaacttccagcccaggtgatatgattggcacccaggactg aataaaatggtgtatagtgtatttctcactatataaaagcgactaactta gtcgacctcctcgatcttggggccagcaccgccgctcgcagccggcgcgt cctcgtccatgcctccgggcatgccagcaccggcgccctggtacatcttg gcgatgatggggttgcagaggccctccagctccttcatcttgtcctcaaa ctcgtcaacctcaccgagctggttggcgtcaagccactggatcgcggcgt caacggcgtcctcgatcttcttcttgtcatcagcaggcagcttggaggcg atcttctcgtcctggatggtgttcctcatgttgtaggcgtagttctccag ggagttcttggcgtcaaccttcttcttgtgctcctcgtcctcagacttgt acttctctgcgtcctggaccatcttctcaatgtcgtccttgctcagcctg cccttgtcgttggtgatggtgatcttgttcttctggccagtggtcttgtc ctcagcaga
Download
page-top