Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591860
Length 600 bp
Fasta Format > rwhsd10f21
aacaaactcccgtgtctgctcaaagggagtgaacgaacaatcaaacgctg atacaaaatagatacaacagtggccagctatgcaaagctggctcgatgta cgtactcctatctctcacatggagatcatatcagagcatttattcatgta tatgtatatatgtgtgtgtgagacctcaacgtactcagcatcaatcgctg gaactataatcggcgatgatggcggccagaaatcgatcagtggatcttag agcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttg gagggaatgcctgcggccttgttggggttgagccctccggcaacactctt gaggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccgg ccaatttcctgacgccgctgcagcaggccccagacgggctggtcccgctg cccttcgcataggcgacgcagggggtcaaggcagagctcacctggccgca gctgatggccgcgtcggaggctgcgaggatcattgccgccaccagggcga ccagcacgagcttagtagctgcagtgcgagccatctcgaccgagttagct
Download
page-top