Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591856
Length 602 bp
Fasta Format > rwhsd10f14
aggggcctcgagggctccatacataagctcgaaaacacaaaagtcagcgg aagcaacaatatctgagtacagacatgagttagacaagtttgccttaaga aggctagcacaaaagcagcaacgatcgaaagggcaaggcctcctacctgg tagcctcctaactactcctggtcgtcggtggccttcacgtagtagtaggc accctcggggtagtagtagtcgtcggtggtgtcgtctggatcctgggctc caccatctggttgctctggcaaggagggtcgtcgtcgatgtagtcgatca caggggcagcatcggtctcgggtcgagcggccaagaaaggccctcgacag ctttgtagcagcaggggatgacgaagacggcggtggtcaccggcgacgca gaagacggagacaagctcgatccgctcgatgccgagcccgtcgtctctag tggctcggctcaggcgacgcagcggagggcgacgaagctccgtgacatct cgccggggctcggggtcgtcggagagcgcgggatcgacggcggtgagcgg caaaggctatcgggagtgggcggatctancgagggcaaaagggggaatgc ag
Download
page-top