Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591855
Length 713 bp
Fasta Format > rwhsd10f13
gtgatgtaactttcacaattgctcagtatgctgctccgagaagattatgt gctgagcaaatgaatgatagtacagctgctggcttgctgcataaacttca gagagcagagctcaaattgtacagacaaaccctcgcacaaccaagtttca tagcttggcagtgcttgagcaaaatacaggaggaacatttacaggcttct ttgcccctgtatgatccctacatatttgttcttcacaaagcggcggagag aggaatggttgcttgcatgcctgttttacaggcatgtgtcgcaaagcaga cgtccgtcgtctcaaggaactcctgggtcttcaccagaatcagtgggatg tagtcaaggacaagcctcttgcactgcggttcgtagttcttcgccttgct gcatgttttgaaaagaagcccgactatctccagcttggtgttgggatcct taagcatcataagaacttcaacaagaacatgatggcatagaccacaggca tcccctcgtgtggacgaccgagtcgccgccccctttgggcagaggtgcgc tgattcacataactcctcaggtttaactacagaaacctccaagaagaaca cgggaatgtagtagtcgaccagcgtgatgcactgctgtcttagaggacca aggcttgcacacgtgtggtggagggcactgagaatctcggcctgtgtttc gttttgtcgcagg
Download
page-top