Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591846
Length 758 bp
Fasta Format > rwhsd10f01
atcgtacacttatttggtttctatataacgcttggccggttgcaaactga tcagacaaccgagctacacggtgactttactatgcaactactaagttcct cgcctcgacactgaatgtgcaccaccataacgtacgcacttgtcataaat tacatttcctgcgtcatgcattgtgatgacgtctctgcggagtacaggct acagcttagcgagggtctggctgtatgctggatcgatgcagacgacgacc ttgccgacgctcttgccagaatgaagatactctacagcatccaccgcgga agcaacgcccaggaatttcttagggtcgagcgagacctttagctttccag aggcatacaactcaaatagtttgtcaagatgatcttgccacatgtgagca tgttgaaccaggaaaaatccagccacagtttgacttttagcaagaatctt ctcacatagtccagtgtagttcttcggcttccatccctcctctccttgat actgagagatcataccaattacaatgaggcgtccatggactgcgagcgca ttcaagcacaaatcaaacatgtccccacctacagattcatatataatatc tacaccttttggaaactccttttccagaacatctttgatcttctcatgct ggtagttgataactcgatcaacacctaaggaagctagaaatgcagcctta ctttcgccaccacatgtggcaacaaccttgttgcctgctagttttgcang ctgaacng
Download
page-top