Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591844
Length 756 bp
Fasta Format > rwhsd10e22
atacatcttacatggaagaatgttaaccctgtctcattcaactatgagca gaacatacttacaagatagccgaccaccacagagaaaggaaataagaact gaattacttatttacttataaaacataaaatagttataggatgtacatct gatgtgagggcataagttgaagtacaccggggaatgacacatgtttacac tgccagacacgtaaaaaggccctttgacaacatactcgccgcactgtact gttctcaacccattagcttcagacaagttcaattttctgctctgccaccc aagattcttttggacccagctgtactgtttcaatctttgcattttcaaca caaacaaagtctttgtagcatgcctccatctgcaagtgaggattccacaa cactgcatctgaccagtttgtgtttgagattacaattttgtcacccaatc cattgtccagggtaagctcactcggtgcaccaaggtaaacacagtcgaca aatcctggaaaggtcacctcgtccctttcttctttgccctccagaggatt tttagggtcaggatccttattgagggtcttgctaccttcgagacctttca ctgaaacaccagcaattgaagcactgaaataagtgtggagggctgagttg aatgagaaaggtttatcgtctgtatttattattttcagggtagttgacag gcttgtanagtgcagcacaaccttgtataaagcttggaaactaaaatccc acattg
Download
page-top