Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591843
Length 558 bp
Fasta Format > rwhsd10e21
attggctaacattttaaatgccagtttatcatcatgtgatagatacatct caatttcttgactggtatgtacaaggcacaagcagaattgccccagccag atcttgtttgctagacagcaagacctgcaacaaggtcttggatacagtaa tcttacaagcaccattctgtgaggtgtgttctagttggaaatttgactct cacttgttacacttgtgtaaattccaacgcgtttccatccgggtctcgtg caaagatcgctggtcgcccggatttgctgagcgtgtagctgattccagct ttgtcaaagatttctttcaacttcaagacatctctgattgctatacaggt atgacgatcacgcccaccatgctctgggcgtcctgtcagtggatctggat ttggcagctccatcaagtggatcatctcagaaccaacccagagccaagca cctctgtacggaagcttgtcatttggcctagcaggattcaccttaagacc aaggaggtcctggtagaatgccatcgacctttcaagattttcacatagta ttccaaca
Download
page-top