Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591838
Length 615 bp
Fasta Format > rwhsd10e07
atgatggatccatggacgacgatgcataagctgattgatcgaccagttgg gagtgactggctagtgggtgatgcctgggtggcagaaggcgccgttgagc cagccgtcggtgatctgcttgtaggcggcctcggtgaggtggatgccgtc ccagctgaggtgggacgccgggctggcgcaggcggaggcgccggacatgc cgcaccgcgcgctgttggcgtagttgtacttgcctccccccgacccgcag cacgcctcaaacaccgagctgaacccgtatttgctggggctccggaccat gtcgtanaccccggcgtagaagtcggcgtacatgatgcgcgccgacttgt acttggcctggagggcggacaccttggcctgcagcaggctgttgtggtac gtggagaggtcgttgaacttcttgaggcagccgagggcgtcgtagtcggc ggcgctggaggtgccgtagatggtgaggtagatggggaagcagccgatgg ggagcacccccggcaccaccacgtccacggcccccatcgcgaccagcttc tccacgccggcgccgatggtgtccacgatctgcggcgcgtacgtgctcgc ctggtccgtgttgta
Download
page-top