Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591835
Length 656 bp
Fasta Format > rwhsd10e02
gcactttcccttacaggagcaaaatgtgacaagggcaaagttttcaccaa cacgatcataagttatcaacttaaaagtgctgtaaacacaaaggaaccat cctccttcaacatctaaaggcccgacatactgtctattccatgcaacggc aatctaagacctgggcttctccttcttttccttgaagagggcaagcagag acacaccagacaccttgacgaccttgaaccgaacaccgggaatatctccc acagcatgtcccttacgaccgaatccagcaatcagcacctcgtcattctc ctcgatgaagttcaggcaaccatcattgggaacgaaggcagcgatcttct ttccgttcttcacaagctgcacacgagcacacttacggatggcagagtta ggctgcttggcctcaataccaatcttctccaaaacaatgcccttggcatg agatgacccggcgaagggtttcttccactcgttacccaagtggctcttct tgtatgccttgtcagcccacctctggttcctgcggtgggtcttgagcttg cgcccagctcccataccacgtgtcttacccatgttggcgaaaggggtggg aagaactccgacgaggaggcggcggcggcggctgggcgagggagcgcgag ctggga
Download
page-top