Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591834
Length 663 bp
Fasta Format > rwhsd10d24
aggaaatactcccgggacaacagagaccacgaactagggtaggtaataga cacaagctgtggcataggttcataatattgccaatgaattatttaggaga tatatatcatcatcatcatgactgaaaacaggttctgcccaattaagccc caatcaagcaaagatagtagcttaaagagttgctcctccacggcggcact cgttcagcatgtcaaggtagaactggcacttgctgatatcgcttccgtag tggttgatgcaatcttggaaggccttggaagggttgccacacttgtcatc agcagcattgtccattggagtcatagatgcagcagcctcaccgacaacag tctcatgctgaatggtacggggacccatcacagcatcaacagccctgtgc gccatggcacttccagtaccgaaagccatgccctgagcaatggtggaccc aatcccgctcatgataccaccaccgctgctctgggtggtagcaggtggag gagctggacgggctggcgctggtgggtttctcactggagcagcacgtgga gcagggcgggaagaccttcctcctccgctgcggcgggccatggcggcggg tggggcggacgggcggcgggangaaaccctaggctggaggcggcgccggg agggggatcggaa
Download
page-top