Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591833
Length 426 bp
Fasta Format > rwhsd10d23
tntaatggnaagaccaggtacatcttatttnttatcngaaacggcaagca ggacaggacaccatcaactctcaattgcgacaccaggcgccgcaacctcg atcatccttggcttcttgctggttcctgccatgatggttgctgggagatg ctcctgttcataggccgagagatggactccaagtgctgctctccctgagg gatccaggttccctgaccactgggcatcccactctaccgccttcgccgtg ctgcatgcaacgcttggcccacctggcaccgtcaggatcgccgagttctg ggggaagaacctctcnaatatcatcctgtaacagtaggcctcttttgtag tcngggtgttgtgtgggtanatgaactttgcatttgacatcatcntatct gtcacatttgattctgcgtgagnctt
Download
page-top