Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591819
Length 737 bp
Fasta Format > rwhsd10c23
agagtacttgattagcaactccattacagaagtactagttgatgcggaaa acagaaggtaactcatgtccaactaacatgaaccaggcgtcgtctggcga caccatccacatttattcttcgcatagacaaagcagggacacctctgacc aaaggaaatcagaacgctctactgagtcttggccatgtggcggatcagat cgacaacgcggttgctgtaaccccactcgttgtcgtaccacgagacgagc ttgacgaaatggtcgttcagagcaattccagccttggcatcaaagatgct cgacctgctgtcaccgacaaagtcagtggagaccaaatcttcctcgacat aacccatgatccccttgagttttccctcagatgcagcctngntagccttc ttgatgtcatcgtatgatgcagccttctcggttctaacagtgagatcaac aactgacacatccacagtgggaacccggaaagacataccggtaagcttgc cattcagctcaggaagaaccttgccaacagccttggcagcaccagtgctg ctgggaatgatgttaaagcttgcggccctgccacctctccagtccttgct cgagggaccatcaacagtcttctgtgtggcagtgatggcatgaacagtgg tcatcaaaccctcaataataccgaagttgtcattaatgatctttgctagg ggagcaaggcagttagtggtgcagctagcatttgaga
Download
page-top