Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591815
Length 718 bp
Fasta Format > rwhsd10c15
aatgcgtggtaagtaaatgtttatccaagaaggatggcggttcatatagc atatcagcgaagcatcttacagtatgtgcctgcaataagaaactatcgac aaagttcccatattctgtaaaatgattggattccttttacataaggtggc gcttcatcgtggatctattgtttacatgacttgtcctcaaactgtgcttc ttgtttgcttccttgctgttgaaacatagcagttcttagttcttgtactt catggtctccttctcgaatccaattgttgggaattgtttcgcatattcct ccacatcgtggcgaagctttgcaatttcagcttggatgttgctgtcggat tgcaatgtggcaacaaagtccttcagtttggtacctgctgctgcagcttt aaccttcaaggccaagttcactgccgaatcgaagaagtcagcaaccttgg cgaagtcctcctcaacaaatcctcttgatgtaagtgcgggggttcccatc ctgatgcctccgggtaccatagctgaaacatcaccaggaaccgtgttctt gtttgctgcaatatgcacattttctaaaaccttctccacacgtgaaccat ctattccctttttcttgaggttcaccaaaactaaatggttatcagtccca ccagagacaatgtcgtaaccttttgaagtcaagctctcagcaaatctagc anagttactcataacttg
Download
page-top