Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591806
Length 666 bp
Fasta Format > rwhsd10c03
tctgctgcatgtcaccccaagatctctgaagttttataaactcccgtaca cttaaatgaatcaccccttgcaatattgcacatattgcaagtcttacact tctatgtgcacaaatttactatttacattcctccaacgagccacatatat atgatgatgctatatctacaaattgcaatgtacacagcttcagaatttgt tgaattcttcagatcccatgccctgccttgccatgcaggatgcagcagcg acagtgggggaagatccctcctatcagggtggtgctcgaggtttccgtga gatggatcccggatcatatatatgatctctcaaggatgctctgcgacagt atctatctaggccacaaacgctgacgaagaggaagaaccgtatatctcgt ttgcctgagccagggagacgtacacgacatccgtcagcaagctgtgggtc cggccgtagaaaatgtacacgaagacccccatcaccagccataccccgac ccgcatccacgtgccaccccctagatttatgagcaagtatgtgtttatga gaatgcacatcaccggcagcagcggaacaaacgggcagatgaatcctcca gagtgaccaaatgagtgccttccgtcgtcctggtcgatccaggagagcat tccgagaccagctagg
Download
page-top