Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591804
Length 403 bp
Fasta Format > rwhsd10b24
agaagctgaaaatataaacaaatccctgcntcttatagaaaggancccaa ncattaaactgaaaacgcgatcgggtccacgctgtgccgcanatggatac aatcatcnccgacgcctgggacagaccacttggtccggcnagacctctgt agnnagccncagactccaatttggcnctgcactgccttccttctggcatc gtggntgggaggancaagtatggccgcccttcnaccagaggaatcgatgg attgttggaggagaccggtgtcgtagctccttcngatccaccatcgaata agctcaggatccccatcaccancttccaacgagatagcggaagccctttc ccagatgcggggataacaccncctacgccggaagctcggatccggcgagg ccc
Download
page-top