Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591803
Length 416 bp
Fasta Format > rwhsd10b22
aaatatcctcacagggttcaaccacatagctcccaacattacattccagt cttggaacatcaaaactctattaatgggggtaaacaaggagagcctgcta acagttactaaagcaagatggatagaacattcccactactagaaaaggca ttgtctggcttgatgcttaaacctcctggacgctcaaacctggtgggagg gactgcttgagcttgttggccttgtcggcgtcgaagacgcagagcgtgta gaggtacctggagcagcgcaccttgaacttgacggcgtccttggtcctct tgatccgcaccgaccgcgcgtccttccggcgcgccgtcagcaggaagtcc ttgatctcgtggatctgcttcggcatggtggacgactgtgcgcacccgag gaggaggcgacggagg
Download
page-top