Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591793
Length 626 bp
Fasta Format > rwhsd10b05
ggcagatatcatttgtgcatttacagcgactcaacaacataattcagaca caatacaacagtcatcttccttttgatacaacgagggagcgaaagaatgg caaccttcacttaaatgtctccaaaactggactgcggcgtcaaacggtcg tctcaaaaactgataagtgggggcacaacaagagtcaatctatagttctg tactttttacagcctttcagccctcagaagcctttccctggccttctgct cttccatttcgttcatccaatccgaaatctggtagacgcctttccaaata actagtcccagcaccaccaatccagctaacgcagttatcaccacgagata ccacttgattcgctgccacattgaaacctgaacaggttcctgtgctccgc ggtcacgcttcttcctacgtttgggcacgtttgcgacttctgcagcaggg ttcttattctcctgaactttccgttgatgtaactctgcagctggaacatt gacctttttcacacaatctccaccacatgcaattaggccaactccaaact ggccttttgctacttcttttgggtcacgaccagaccttcggtactccttg agaacatcttgacatacccactcttt
Download
page-top