Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591787
Length 306 bp
Fasta Format > rwhsd10a19
atgcagcgatgcatcgaagcaaccgaacaanatgcatgcatgactgactc nnactantantatatagcgaggnacgtacgtacgtgcgcgctgacgggga cgattgatggctgctgtgaganagctgctgcggtacgttgatncnatgac cggtgcaggttctaatttttaaanagcgctctcangaccggacgtggnct tggtgacgccggtgaactcaaccttggtgccgagcaggtcgaccccnacn tcggcggtgaaggtgtcgtaccggaggaacagctccacnaccaggagcct gcccac
Download
page-top