Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591784
Length 657 bp
Fasta Format > rwhsd10a11
tacaacaaactcccgtgtctgctcaagggagtgaacgaacaatcaaacgc tgatacaaaatagatacaacagtggccagctatgcaaagctggctcgatg tacgtactcctatctctcacatggagatcatatcagagcatttattcatg tatatgtatatatgtgtgtgtgagacctcaacgtactcagcatcaatcgc tggaactataatcggcgatgatggcggccagaaatcgatcagtggatctt agagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcact tggagggaatgcctgcggccttgttggggttgagccctccggcaacactc ttgaggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagcc ggccaatttcctgacgccgctgcagcaggccccagacgggctggtcccgc tgcccttcgcataggcgacgcagggggtcaaggcagagctcacctggccg cagctgatggccgcgtcggaggctgcgaggatcattgccgccaccagggc gaccagcacgagcttagtagctgcagtgcgagccatctcgaccgagttag ctgtagttgtggaccttgtggtggtgggctagctcacggagagagggtgg gatagct
Download
page-top