Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591782
Length 721 bp
Fasta Format > rwhsd10a09
aatccccacagntgaatgtaatataacacaatcagatgcagcaaaggagc aggtacaaacataacggaagcaattcgaaaaaaatgagaattattcctgg cttggtgcgtccttagaaacctccatgggctctgctgcttctgctgcatc tcctttcttgcctttctttttcttgccaccacccttcttctttgactttg tgcccaaagcaagccaagccttgatctccacgtcgtcctcgatggatttt gagggctccagttgctgtagtggatgtgacgttatcttgtcagacccatt tggcatcaacaacacggngaatttgatgtgggcaaccaggtcccctggct tctcatgtanaacagggtatggctgcaacagctcatgattcatgcattct accaaacctaagcgtgcacgcttctcctccagcgccctagcagtgaatgg catgattgggaacttctggctaatctcactgaagatgaaccttgatgcct tcatcttcaagtgatagttcttgtctacagctctcttgtaaatagtggtc tgcttctcatccaatagcttcggctttccctcgccagtgctggtgacaat atcaattgcatacacttcattttcttcaaattcagcatcatccacctttg tatcagcgtttgaaacactaagtaccactttgttaccatcgatgacgaat tgtttcagctgatggctaana
Download
page-top