Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591779
Length 705 bp
Fasta Format > rwhsd10a06
attttgtttccataaaaaaccactcttcaaacaaacgatcttgctaccac agttacaacatattactatatctcagaaaataaatttctggactaacaat tcaacacacagatcacatatatataaagtggctgcatgcatctcccagat gcagaggccggggttcgtcctccttttctaaaaagaagatcacatatata cgcccctgtgaatgatataggataattgattgtgttattcacatggatga accgtatggtacaactatagacatgacaaatatggtgaggaacatgtgga tttgaattgccgacttccagcatgacagaataaggccatcaagaatctgg attgatgacttccaggctccaacgtcaccagaaaggacgcattcgttctc aaaaaaagaacggacgcattcttatgccattgagcatgaaagggactact gcaaaaatgccagcaactgtgcagacaatcaatccaggcttctcccggtg atccaaagcaacaaagaatagaagaaaagcaccaatataccagggaattg cagccaagaagaaccctagtaagaacaaagcccagccgacgccgacgccg cagaacggcagccgcggctcccggactgggaggccctccacgaagacctg ctgctggatagtgcacgggaaagcaacaacgccctgagcactgcgtcctt tcagg
Download
page-top