Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ591777
Length 661 bp
Fasta Format > rwhsd10a01
atggtacagaatatttacattgcggcgtggcgcacatgagcagccgcgct ttcgcgtgaactatgcacctctcagatgcagcttcaacatgatcacttcc atgagaactaactatgcacctctgagttcatgtgattatgtggaccactc attgctccttttgtgcctctgggaacaactgcagcgcttgcgtcgttagt cgcttcgcgacaaagaacaagggtattctattcagtttccctccatgcaa agatttcagttcatcaatggtttgctcttcttgtgtaccagcagctgtca tgacaaacagtgggtatagtattgccatcacaccataacttgtaagagga gagaagaagaaaatcggaagtacacatggactaccaaatccggcaaagaa agcccaatttgactcaaagaaatcaagccggtggttcaggctcactgcaa agaagttccacttgtactcgaagcagtagtaggcatacatcaaagacagt aacatgaagttcattgccttaccaaggtaaggtatgcaaccaatcactgt aacctcagcaaagaaaatagtcaaaagaagtatcgaatagacctgctctc caacaccaatcgcaaccccatcaaatccttcaggcctatctgctgataca gatgtgctgtg
Download
page-top