Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ700453
Length 472 bp
Fasta Format > whsd20b14
ggcgctacccgccggaggcagaggagacgaggaggagttggccaaggaga acgtgaagaacgcgtcctcctccacgggcaacatcacgctcagcgtcacc aagagcaagccggagaccggcgaggtgatcggcgtcttcgagagcgtgca gccgtcagacaccgacctcggcgccaaggcgcccaaggatgtcaagatcc agggtgtgtggtacgcgcagctcgagtctaactagagcagagcagaagtg aagatactcatcttgtgtgcatgcgtacgtgggttgatcggtggagagga aacaatcgaggcaacaatgtgtgtttgtgtgtgtatctagtaatctaaac ccagggtgtcggtttatattttagcttctgttattgtttcttcctcgcct actcatgatattgatcccccatgaatgttcacaaaattgtctgtggacac tttcttcgttttaaaaaaaaaa
Download
page-top