Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ700440
Length 634 bp
Fasta Format > whsd20a15
cgccgcctcctctctcgtcccggcgcgcttggagctcgacctacccgcgc gccgcccactatgatcatctccaagaagaaccgcaatgagatctgcaagt acctcttccaagagggggtgctgtatgccaagaaagactacaacctggcg aagcacccgcagattgacgtgccgaacctccaggtgatcaagctcatgca gagcttcaagtctaaggaatacgtcagggagaccttctcgtggcagcatt actattggtacctcaccaacgatggcatcgagttcctgcgcaacttcctc aacctgccatctgagatcgtgcctgccacgctcaagaagtctgccaggcc tcctggccgcccactcggttctggcccacctggtgaccgcccaagggggc cacctcgctttgagggcgacaggcctaggtatggtgacagggatggctac cgtggcggtcctcgtggtgcacctggtgactttggtggtgagaaaggtgg agcccctgcagagttccagccatcattcaggagctctggtggtggcggct ttggccgtggtggtggtggtggtggctttggccgtggtggcggcggcggt ggctttggcactggcccaatggantgaactttcc
Download
page-top