Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ699663
Length 560 bp
Fasta Format > whsd17o17
acctgcatctcggattcaccgcagcgcgaccaaaccctcangngatcccc ggcacctcctccccgacgcttcagccatggcaggaatggcaccggaaggt tcccagtttgacgctaanaactatgattctaanatgcaggagctgctgaa ccaaggtgagactgaggagttcttcacctcttatgatgaagttcatgana gctttgatgacatgggtctccaagagaacctcctcagaggaatttatgct tatggttttgagaagccttctgccatccagcaaaggggaatcgttccttt ctgcaaggggcttgatgttatccancaagcacaatctggaacaggaaaga ctgctactttctgttctggaatcctccaacagcttgactatggtttggtt gagtgccaggccttggtccttgctcccacccgtgagcttgcacagcagat tgagaaggtcatgcgtgcacttggtgactacttgggtgtgaaggttcatg catgtgttggangaacctcagttcgtgaggaccanaggattcttgcaant ggagtgcatg
Download
page-top