Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ698458
Length 253 bp
Fasta Format > whsd12o13
gggcatcccccaccgtgccccgttctacggttagactaccggtggaaacc actctcaaaagtgacaatgctactactagtattgcaatgcaatgtgtgtc ggttgggacttgggcctgagtagtgaagtgatccagttagtagatcacta gctaggtattagctatagcatgcatggtatatatacttgtatatatatac atatacatacacacaataatgtaggtggagtgtgtgtaaatataaaaaaa aaa
Download
page-top