Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ698344
Length 719 bp
Fasta Format > whsd12g09
cgccgcgcacccactcccgctccccacgatgcggcacctcctcctctccc gtctcntccgccgcgcctcctccccctcccagcctcaccacaacctccaa ctcatccgtgctctctcctcctcctcncctctcccggcctccgacaccga cctccgcaagtacgccggctacgcgctcctcgtcctcggctgcggcgccg ccacctactactccttccccttcccanccgacgcgctccacaagaaggcc gtccccttcaagtacgcgcccctccccgacgacctccacaccgtctccaa ctggagcggcactcacgaggtccacacccgcgtcctcctccagcccgact ccatcccggcgctcgaggatgccctcgccacagcccacagggagcgacgc aggctcaggcccctcggctccgggctgtcccccaatggcctcgggctctn ccgggccggcatggncaaccttgcgctcatggacaaggtgctagacgtng atgtcaagaagaagaccgtcacggtgcaggctgggatacgtgtcgccgag ctcgtcgatgcgctcagcaagcatgggctcacactgcagaactttgcctc cattcgagagcagcaggtcggcggcatcattcaggttggtgcccatggta ctggtgcgagattgcctccaattgatgagcaggttattagcatgaaactg gttactcctgccaaaggga
Download
page-top