Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ698246
Length 415 bp
Fasta Format > whsd11p07
tggcatgtcggtagaatgcttcgggcctttggtagttttgtttctgaaca aacgggctagatcctcctgtacttcgtttccttctatcatttgacatcag aatgataaacagacagactggtgcttgctcaacttgtcctgatgtccagc ttattactccctctgtcctgaattacttgtctcggctttgtcttgacgga tgtatgtagacatggtttagtgtcagatacatccgtatctgaaaaaatgt actccctctgtcccacaatataagagcctttttgacactacactaagtgt taggaacgctcttatattatgggacgaaaatgctcttatattatgggacg gagggagtaaaagacaagtaatttgggaaggtataatacctttttacctt tgttcaaaaaaaaaa
Download
page-top